UCA1

ENA TPA Accession :
Print
Download


Entry NameAlias
UCA1 UCA1a, CUDR, UCAT1, LINC00178, NCRNA00178, GCAP2, GUCA1B, GUCA2, RP48, ENSG00000214049
Characteristic
Located in cytoplasm ((Kessler (2011))). Spliced and polyadenylated with 3 exons ((Chen (2008))). Multiple isoforms (1.4kb, 2.2kb and 2.7kb). The 2.2kb isoform contains an extended final exon compared to the 1.4kb isoform while the 2.7kb isoform has not been characterised ((Chen (2006)), (Kwok (2007)) , (Chen (2008))). UCA1a refers to the 2.2kb isoform ((Kwok (2007)), (Li (2012))). Sequence is mainly repeat elements. Initiates in an LTR, exons sample pieces of a HERV-H element and longer 2.2kb isoform contains a second LTR at the 3' end ((Chen (2006))).
Expression
Upregulated in gastric cancer ((Zhang (2013))). Widely expressed during embryonic development, detected at 5weeks to 28 weeks ((Kessler (2011)), (Chen (2008)), (Chen (2006))). Not expressed in normal adult tissues except heart, spleen and placental tissue ((Chen (2008)), (Kessler (2011)), (Kwok (2007))). Upregulated in colon, cervix, lung, liver, mammary, eosphagous, stomach and bladder cancers ((Chen (2008)), (Chen (2006)), (Zhang (2013))), however, not expressed in renal cancer or hyperplastic prostate. Identified as a biomarker for bladder cancer ((Chen (2006))).
Function
1.4kb isoform Promotes bladder cancer cell proliferation, tumorogenicity, invasive potential and drug resistance ((Chen (2008))). Regulates cell cycle progression through CREB via PI3K-AKT pathways ((Chen (2012))). Overexpression of 2.2kb isoform caused resistance to drug induced apoptosis, ((Kwok (2007))) and promoted tumoregenicity ((Li (2012))). Also enhanced proliferation migration and invasion of bladder cancer cell line ((Li (2012))). 2.2kb isoform promoted transformation in-vitro, possibly because resistance to apoptosis is an important step in tumourigenesis ((Kwok (2007))). Given its expression during development, may also have a role in embryogenesis ((Chen (2008)), (Li (2012))). UCA1 ( described as CUDR ) was found to cooperate with SET1A to accelerate hepatocarcinogenesis and promote malignant transformation of hepatocyte-like stem cells (Li 2015) UCA1 ( described as CUDR ) acts as a sponge cushion in which enhances the phosphorylation of RB1, C-myc expression and the interplay between the SET1A and pRB1 (Li 2015).
Conservation
Orththologues in primates, including chimpanzee (Pan troglodytes, XM_001159928.1), Sumatran orangutan (Pongo abelii, AC210534.3), and rhesus monkey (Macaca mulatta, AC197808.1). No homologues were found in other species. ((Chen (2008)))
Human Body Atlas
Sort values
Species
Species UCSC Genome Browser Link
Homo sapiens (Human) hg19 chr19:15,828,947-15,836,321
Literature
Pub Med ID Author Title Year
23801869 Cao Analysis of long non-coding RNA expression profiles in gastric cancer. 2013
22576688 Wang Long non-coding RNA UCA1a(CUDR) promotes proliferation and tumorigenesis of bladder cancer. 2012
22285928 Yang Long non-coding RNA UCA1 regulated cell cycle distribution via CREB through PI3-K dependent pathway in bladder carcinoma cells. 2012
22118674 Altun Activity-based chemical proteomics accelerates inhibitor development for deubiquitylating enzymes. 2011
18501714 Wang UCA1, a non-protein-coding RNA up-regulated in bladder carcinoma and embryo, influencing cell growth and promoting invasion. 2008
17416635 Tsang Induction of drug resistance and transformation in human cancer cells by the noncoding RNA CUDR. 2007
16914571 Wang Rapid identification of UCA1 as a very sensitive and specific unique marker for human bladder carcinoma. 2006

showing of total 8 results

Sequences
Sequence Name Sequence Accessions Species Fasta Sequence
uca1_hg_1 NR_015379.3 Homo Sapiens TGACATTCTTCTGGACAATGAGTCCCATCATCTCTCCACCATGCACCTTGTGACTCCCTCCTCTGCTGACAACAGATAACCACCTTTAACTGTAACTTTCCACAGCCTACCCCAGCCCTATAAAGCTGCCCCTCTCCTATCTCCCTTCGCTGACTCTCTTTTCAGACTCAGCCCACTTGCACCCAAGTGAATTAACAGCCTTGTTGCTCACACAAAGCCTGTTTAGGTGGTCTTCTATACGGACATGCTTGACACTTGGTGCCAAAATCTGGGCCAGGGGGACTCCTTCGTGAGACCGGCCCCCTGTCCTGGCCCTCATTCCGTGAAGAGATCCACCTGCGACCTCGGGTCCTCAGACCAGCCCAAGGAACATCTCACCAATTTCAAATCGGATCTCCTCGGCTTAGTGGCTGAAGACTGATGCTGCCCGATCGCCTCAGAAGCCCCTTGGACCATCACAGATGCCGAGCTTCGGGTAACTCTTACGGTGGAGGATTCCCAGCCATATGAAGACACCCTAGCTGGACGATCAGTCCTTGTCAAAAGTCTGACCCCTCAAACTCTACAGCCTCAATGGACCAGACCCTACCCGGTCATTTATAGCACACCAACTGCCGTCCATCTGCAGGACCCTCTCCATTGGGTTCACCATTCCAGAATAAAGCCATGCCCATCAGACAGCCAGCTTGATCTCTCCTCTTCCTCCTGGAAGCCACAAGATTAGGCCGAGAGCCGATCAGACAAACAACCTACAACCCTTAAGCTCCTGGCAGCGCCCAGCCAAGGCCATGCTTCCATGCAACACTCCTTCCAAATGGCCATCCCAGCATGCTTCCAAGCAGGCTTCATCCGTTCCTCTGGACCCTCATCTCTTAAGACCTGCCGCCTATAAAAAGGATTATATCTTGAGACCCTATCCTCTAAAATTTTTTCCACACCCAAAACAAAAAATCTCTGGGTCAAAAGTCTAAAACGCTTAGGCTGGCAACCATCAGATCCTTGCCCATGGTGTCCTCAAGCCTACTCTCATGAAATGGACAACAGTACACGCATATGGGGCCAGTTCCACATATTTGGCAACCAGACCAGCATCCAGGACAACACAAAGTATGTTGTTTGTTGTTAGAGGGCTTGGGACATTTCACTCTTTGCCAGCCTCAGCTTAATCCAGGAGACAAAGATTATTTTCCTTATTATCTCTTCTGCATAGGATCTGCAATCAGAACTATTGAACTTCTCCATTCAGACCGCCACTCACACCTATGGGAAAAGGGTAATGTATCATCGGCTTAGCAACAGGGAATACTATTCGTATGATGGAAAATGGGGACAAAAGGCTTTGGTACATAAAACATTATTCCTTCCTTGGCCTAAAAACTCATCGCCACCTACATTAAAGCTAATATGCCTGATTACTGTTTTTAGAGAACTTATTTTATTAGGGCAGTTCCAAGCTCAAAAATACGCTAACTGGCACCTTGTTAGCTACATAAAAATGCACCCTAGACCCGAAACTTACTAGACTCATTATAAAATTTTCTTTAAGGTGTCCACGCAGTCCCTGGTCACACTTGAAGCAGTCCGGAGAAATATCAGCCCTACCCCAGTAATCCCCAGAAGGAACTTACACTTTTTTTTAATCTTTTCCTACAACTTCATATTTTATAAATAAAAAGACAAAAATGTCAGGCCTGTGAGCTGAAGCTTAGCCATTGTAACCCCTGTGACCTGCACATATCCGTCCAGGTGGCCTGCAGGAGCCAAGAAGTCTGGAGCAGCCGAAAAACCACAAAGAAGTGAAACAGCCAGTTCCTGCCTTAACTAATTAACCCACCTTACGACATTCCACCATTATGACTTGTCCACCATTATGACTTGTTCCTGCCCTGCCCCAACTGATCAATCAACCCTGTGACATTCTTCTCCTGGACAATGAGTCCCATCATCTCTCCACCATGCACCTTGTGACCCCCTCCTCTGCTGAGGATAACCACCTTTAACTGTAACTTTCCACGCCTACCCAAGCCCTATAAAGCTGCCCCTCTCCTATCTCCCTTCACTGACTCTCTTTTCGGACTCAGCCCACTTGCACCCAAGTGAATTAACAGCCTTGTTGCTCACACAAAGCCTGATTGGGTGTCTTCTATACGGACACGCGTGACAGGAACCTCAACCCAAAGGCAGTCTGATGAGGTGTCTAAGATAAAAGTAGCGGCACAAAGGCTTTTGTAAACAGAGGCGTTTCATGTGGTTTTCCTTTCCTTTCCTTATATGTGAAAAGGTGACAGAAAAGAAATCTTCCTAAAAGAGTCAG





lncrnadb version 2.0. lastupdate : 03 Sep 2015