lncSCA7

ENA TPA Accession :
Print
Download


Entry NameAlias
Lnc-SCA7 ATXN7L3B processed_pseudogene and lincRNA
Characteristics
Retropseudogene, from retro-tranposition of processed ataxin-7–like protein 3 (Atxn7l3). Most of ORF degraded, remaining homologous 97 a.a ORF not found to encode a stable protein product.

Single exon

Mouse Lnc-SCA7 has 6 miRNA-response elements (MREs) for miR-124
Expression
Expressed in a range of tissues, highly expressed in brain in mouse and human

Within mouse brain regions, highest expression observed in retina and cerebellum.

Expression correlates well with ATXN7 level in mouse and human

Cytoplasmic localisation
Function
Positively regulates level of Atxn7 mRNA and protein (in mouse cell culture). Both Lnc-SCA7 and Atxn7 have conserved MREs for miR-124, by competing for miR-124, Lnc-SCA7 regulates the level of Atxn7.

Atnx7 is a member of the STAGA transcriptional activation complex. Lnc-SCA7 also positively regulates the expression level of many other members of the STAGA complex with which it shares MREs, including for miR-124. Nb: Would hypothesise this regulation is a mix of direct and indirect effects.

Feedback loop: STAGA transcriptional activation complex, (of which Atxn7 is a member) transcriptionally activates miR-124. Lnc-SCA7 regulates levels of many STAGA complex RNAs, likely by competing for miRNAs, preventing them from inhibiting Atnx7 and other STAGA component RNAs.

In spinocerebellar ataxia type 7 (SCA7) this feedback loop is broken (results from fibroblasts derived from human patients and a mouse models of SCA7). The polyQ-repeat expansion in ATXN7 leads to less active STAGA, lower miR-124 levels and increased levels of Lnc-SCA7 and the abnormal ATXN7 in brain tissue. It is hypothesised this occurs in the brain because this is the tissue where the lncRNA, microRNA and ATXN7 are most highly expressed and therefore the loss of miR-124 repression could lead to disease by allowing the accumulation of sufficient levels of abnormal ATXN7 protein .

Function does not require 97 a.a ORF suggesting Lnc-SCA7 function is RNA directed.

Summary: Through crosstalk with miR-124 and other miRNAs, Lnc-SCA7 regulates the level of ATNX7 and other members of the STAGA transcriptional activation complex.
Conservation
Placental mammals, arose via the retrotranspositon of a Atxn7 paralog, ataxin-7–like protein 3 (Atxn7l3), in common ancestor of placental mammals.

miR-124 MREs conserved in both mouse and human lnc-SCA7
Species
Species USCS Genome Browser Link build
Homo sapiens (Human) chr12:74931551-74935232 hg19
Homo sapiens (Human) chr12:74,537,771-74,541,452 hg38
Mus musculus (Mouse) chr10:112925430-112928995 mm10
Literature
Pub Med ID Author Title Year
25306109 Tan Cross-talking noncoding RNAs contribute to cell-specific neurodegeneration in SCA7. 2014

showing of total 2 results

Associated Components
Component Type Component ID Description Status Pub Med ID
RNA Atxn7 Lnc-SCA7 regulates Atxn7 through miR-124 25306109
RNA miR-124 miR-124 targets Lnc-SCA7 25306109
Sequences
Sequence Name Sequence Accessions Species Fasta_sequence
lncsca7_hg_1 NM_001136262.1 Homo sapiens AGGCGCTCTGAGGGGCGGAAGCGGAGAGGCGGGGCTAGGCCCGACAGGGGAGCGGAAGAGGCCCAGGAGG CTGGGTGAGGCGCTGAGACGGTTTGGCGGTGAGTCCTGGGCCAGGCGCAGCTGAAAGGCCCGCAACCCGG GAAACGTCAAAACAAACAGAAGGACTTGGGATTCCGGAGCAGTCGCCCCTATCGCTGCTCCTGCAGTTGC GGACGCCACCGACCCCGCCGCCGGAGGACTGGGCACTGAAAGGCCTCTAGGCCTAGGCGCGGCCCGCGGA GCCAGACGTGTTGCTGCCGTGAGTAAAACGAGCGCCCTCTCCGCACTCGTTTACAAATTAAAATGGAGGA AATTTCGTTGGCCAACCTGGATACTAACAAGCTAGAGGCCATCGCTCAGGAGATTTACGTAGACCTGATA GAGGATTCTTGTTTGGGATTCTGCTTTGAGGTGCACCGGGCAGTCAAGTGTGGCTACTTCTACCTGGAGT TCGCAGAGACTGGTAGCGTGAAGGATTTTGGCATTCAGCCAGTGGAAGACAAAGGAGCGTGCCGCCTCCC GCTTTGCTCCCTTCCCGGAGAACCTGGGAATGGGCCTGATCAGCAGCTGCAGCGCTCACCTCCGGAATTC CAGTAGCTGCAAAATGAGAGTCTGAAAGTGGCCAGGACAATAACATAGACTGGTCCTGTGGCTTCGAGGA GTAAGCTAAGTAGAAAAAAGTAGAAAAATCAGACAAAAGTTTTAATTCCCCCTTGAAGATCCTAGCATTT AAAAACCCAAAGTGGATAATTTAGGAATCCTTTTTTTAAAGTGTATTACCTGGAGCAAGCTCTGAAGCCC TGGGCAGGAGGAGCTGCACAGCCTGCGGGCCATGCAGTGCCTGTTGATCTCTAAACACACCAGGATGTGC GCAAGATCCTGTAGTGCCCCCAGTGCACAGGTGAGCAGTTGTGTGCCCAGCATATAAAATTTTTGGTTCC TCAGCCTTTCTGTCTGCCTGATGTCAAGGGCTTCCTGGACAGTTTGGACGTTACAGTTCGTCAGGCCGTG ATCAGTGGCCTGCAGTGGGACTGCTCCTTTGATATCTGAACCTCTGTTATGGGCTTCTCTGAGACAAGTA AATGTCAGGTGCAAGATCTGGATACTAACAGTTTCAGTTTGGGAAATCCAAGAAAAAGAATTATCAAGTT TGATAGGGAAGCTCTGTAGCCTTGACTCCAGCAAGAAGAAAAGGTCAAAACCACGTGTTTCCCAAAAGTC CAGACTACAATGATTCAGCTGACTTGAGGACAAGGCCTAGCATTTGGCTGAGCAGAGCCCTCTTCCTTGC CCTCCAACCTGGTGGCATAGGCTTGGCAAATGGACAACTTGGTTGTCCAGACAGGTTGAGGATTCGGTTA TGATCCCCTGGGGAGGTAGCAGGGACCTCTGCAACTATGCATGATTTCTCAAACTTCAAGATTCATGTCT GGATGTATTATGCTGTGGATATAAGTTTAGTAGGGCGGTCATTTCCTACTCTGAGTTACTGGTTACCTAG CCAGTCCATGGGTGTGACTTGGTCCTTAAGTCAGGTCACTATCTGCCTCCCACCCTGGGGGCAGGACTGA AGTATAGAAGAGCATCATGGCTGTGCAGGAGGCTGTGGTTTGAAAACTGAGCCCAGAGGGCACTTTCAGC TGCCCTCAATAATGTGAATGGATTAGTGCTAGGAGCCAAGGAGCAGGACTGGATTATCTCATCTGACTGT GTGCAGAATCCTGTTGAATGTCCCTGTTTTCTTTGGTTGGGCAGTCAGAGCTCTGCTATGGTGAACATCC AGACTGTCACCACTTTCTGTCTGCCGCTCGAAAGGGATAGTCCTTTCCACTCGGTCCCCTTTGGATCTTC TTGACAACAGGAGCAGTCCTTTTATTGTTAGAAGTCAGAGAAAGACCTCCAGAATCTCCTGACTTTAGGG AATGGTATAGGGGAAGATGGGAAGTAAGAGTCACATATCAAAACTACCCTCCACTTTATTCCCTGAGCGA GGGTTTATGAAGTATAAAGGGGTGGGAGCCCCGAGGTGAGCGGGAACGGTGCTGCTTTATTTGAAATGTT TTCTTACCTCATTCTGTGCCCCAGTAGGGGGTCCAGCCTCATCTGTCTGGCTTGGCCCTGTGTTCCTCCT GTCCCCTGCTCCACTGCCTATCTGGTGCCCCAGGTGCTGCTTGCCACTCCAGCTGTCACATTGAACAGTT TCAATTCAGCTCTTAATGCTCCTGCTTCCGAAGCCTGCCCAATTTCTTTTTTCTTGGCCTCTGTTTTTTT TTTTTCTTTCTTTTTCCCTTGTTTTTGTAGAAGACTCAGAGGAGAATCTTTCTTATGGCTCCCTCTGTTG AGATTGGAATTGGAAGAGAACTTAATTTTTTGTATTTAAAATGCAGTGTCATGCCTATAAGCATTTCTCC TATATAGGACTGCTTTGCTAGTGTGCCCTCTTGCTGTGTCTTACTTCATAAGGAGTTGTATCTTCCCACC TCCATTTCAATACTGCCGGTTAGGACCTAAGTAGAAGAGCAGTAAAGGCTGATTGACACACAGGGGGATG GAGTTGGTCCTTGTCCATTCTCTCACCCTTGCTGTGCATGTATCAATCCTTATCCCAGAAGGTACTATTT AGACTGTATAGACTGATTTAGATTACATACTTTAGAGGATTAAGGAAACCATAGAGTTTGGGCCTTGGAA CTGTTACTGCCTTGTCCTAGAGTTGTCCTGATCAGGCTTGGGGCCTAGTTACAGATTAGTCTTAAAGAAT TGCATTAACTTAAAAAAAATCAAACCTTGGCAAGAGCTAAAATAATTTGGAGATATCTTTGCCCTTGACT TGTAGACGACATCTAAGAGGATGAAGAAAGGAGAGTCTAAGTGAGACTCTGGCCTACTTCCTAACAATGT CTTGGAAGTGGGATGATGGTAAAGGAGAAAGGCCACAGTCCAATCCCTCTGCCTTCAGATAGGGAACTCA AATCCTGAAATTACTGTTTTCTTTCTGGCCTTTTCTCCTGGTTAGAGGAGGAAGCGGAAAGTAGTTTTGA GTAATACTTTGTTCATATTACCCCCCTTTTGTTTTTTGTTTCTGGCCCCTCTACCAATAGGGCAGTAGCC TCCTGCCCTGGATGGGTATAAGGTGGGCTTGGTCCAACAGGTGCCCAGAGGGTACATACTCCTTTCTGGG GAGAGAATGCTCCCTACCATATAGTTGACAGTGGTTAGGAACTCTCCCTTTCCCTACCTACCTTCCTTTT AATAGCAGAATTCCTATTTTTCCCTTGATTATGTGTATTGATCACCCTGCAATCCTATTATGTATCTGAG TGTGTGTGTGTGTGTATGTGTGTGTTATGGGGGAAGGGGGGGGTTCTTTAAAATTTCTGTGGTTTGTGGC TTTTTCTTCCATACATTAGTTCCCACCATCGCATGCCCAGGGACCACTGCCTGGCATTATCGCATGCTGG GATCATCGGGGGAGGGTAGTGAAGCTCACCACTGTCCTTTGTTTTGGAGATTTTTATTTTTGCATAAGTA GTCCATCCTATACAGATAGCTGATTAACTGTATTCCCCTTTCCCCTATGGCTGCTGGTGTAAATAAACTG CATCTCCCCATTGGTAAACAGTAATAAAATTTTAAAAAATGAAAAAAAAAAAAAAAAAAAA
lncsca7_mm_1 NM_001033474.2 Mus musculus GGAAGTGGGGGGGCGGGCCCAGACTGTCAGCGAGAGGAAGAGGCCCGAACGGCTGGGTGAGGCGCCGAGA CGGTTTTCGCGGCGAGCCGGGCTCGGGTGCAGCTCAGAATCCCGAACTTGGGTGATCGTCGCAGCCGAGC GAGCGTTGGGGCTCCGGAGCGGCGGTTGCTGTCGCCGCGGACGCCGCCGTCGTCGCCGTTGCCGTCCCGG AGGACGAGGCCCGGAGAGGCCTTGCAGGCCTAGCGGAGCCCGAGTGTGCCGTGAGTAAAGCCAGCGCCCT CCGCACGGTCGCTTGCCGGTTAAGATGGAGGAGATTTCGTTGGCCAACCTGGATACTAACAAGCTGGAGG CCATCGCCCAGGAGATCTATGTAGACCTGATAGAGGATTCCTGCCTGGGCTTCTGCTTTGAGGTGCACCG GGCGGTCAAGTGTGGCTACTTCTACCTGGAGTTTGCAGACACTGGGAGCGTGAAGGATTTCGGCATCCAG CCAGTGGAGGACAAAGGCGCGTGCCGCCTCCCGCTCTGCTCCCTTCCTGGGGATCCCGGGGACGGGCCCC AGACGGAGCTGCAGCGTTCACCTCCGGAATTCCAGTAGTCACCACCTGAGAGAGGGCGACACAGTGACCA GGACAATAATAGAGACTGGTCCCCGTGGCTTTGGAGGAATAAGCTAAGTTGGAGAGAAAAAAAATTAAAT CAACAAATAAAGGAAAAGCAAACAAAAGTCCCATTTACCCCCCTTCAAGATCTTAGCATTAAAATACAAA AAAAAAAAAAACCGAGAAGGCGTAAAACGAACAAAACACCCAAAGAGGAGAATTTAGGAATCCCGGTCCA TTTGAAAGGGTCTCCCATGCCAGCTCTGAAATCCTGGGCAGAAGAAGGTCCAGAGGCGTCGTGCTGTATT TTGAGCTGTATAAAATACATGTGGATGTGCAAGGACCCTGAACTGTCCTCGGTACACAGGTGAGCAGCTG TGTACCCAGCCTATACAATTCTATTTGTTTCTCAGATTCTGCATCTGCCTGATGTCATGGGCCTCCTTCG AAGTTTTAGATGGTGTTGATGGTCAGGCCCTGATCAGTCAGCTTCGGTGGACTGCTCCTCTGATTTCTAA GCCTCCAATTGGGCCTCTTTGATACAAATAGAAGTCAGGTATGTGACTTAAATACTAAAAATATTAATAT TCCCGTTTGAATTCGATGGGAAGCCCTTGTGCCCTTGTCTTCAAGAAGTTCCAAATCACCTGTTTTCCAA AGGTCCAGCATTTTGTGGGGACAAGGCCTTGCCTTTGGCTCATCAGAAGACCTGTCTTTCCATCCTACTG AGTGGCAAAGGTTTGGCAAAGGACAAGGTGGTTTTCAAACAGCTGAAGATTTTCTTTTGATGCTATGAGG ATGAAGTGTACCTCCGCGACTGCACATCATGTCCAACTGGAAGACTCATGTCTTGAATTACATACTGCGG ACATAAGTTTGGTGGGACGGTTTTTTCCTACTTTTGAGTTACTGGTGATGTAACCAGCCCATGGGTCTGA CTTGATCATTATGACAGGTCGCTGCCCTCCAGTGGTACCACTGACCTACAGAAGGACATCATGGCAGAGC AGGAGGCTGTTTAAAAATTGAGCCAGGAGGGAACTTTTTTCCATCTGCCTTCAATAATGTGAATGAGTTT AATGCTAAGAGCCCTGAAACAGGCCTGGTTTACCTGGTATGGTTGCAGAATTCCTTCATCAACTGGGCAG TCAGACCTCTGCTGTGCTGATTGAGACTGTCTCCACCTTCTCTGCCCTCACAAACAGCAGTTCATCACTT GGTCCTCAGAACCTCCTTCCAGCAGGGGCTGTATATTTCTTGATGGAAAGTTGGAGGCAGGGTTAGAAGT AAAGGGGAAGTGAGTGGCATATCAAAACTGGTCTGTTTCAGTCCCTAAAATGGGGGGTTATGGAGGGTGG GAGTCCTGAGGTGAGCAGAAAAGAAAGGTGCTGCTTTATTTGAAATGTTTTCTTACCTCATTCTGTGCCC CAGTAAAGGGTCCAGCCTCATCTGTCTGGCTTGGCCATGTTCCTGTCACTGCTCCACTGCCTCTCTGGTG CAGCTCATGATTCCAGGTGCTGCTTGCCACACTAGGTTTTCTCTCGACCAATTTCAGCTCATCTTCCAGT GCTGCTCCTCCGAAGCCTACACAAGTTTCCTTTTTCCTTTTGTTGTCGTTTTCGTTTTCTAACTTTAAAT TTTTATGTTGTTTTGTTTTACCTGTTTTTATGGAAGCCTTAGAGGAGAATCTCTCATGGCTCCCTCTGTT TGGATTGGAATGGGAAAATAACAAAAAAAAAAAAAAAAAAAAAAAACAACCTTTTTTTAAATTTACAAGG CAGTGTCATGTCTAAGTGTTTCTCTTATATAAGGCTGCCTTGCTAGTATATCTCCCTGCCTGTCATGAGT TCTTTCTTCCCATTGCTACTTGGATACGGCCTCTTAGGACTTACTGCAGAGCCAGGAATGCTGGCATACA CAAGGAAGGAGTTGGTTCTGCTCCACATTTCTAATCCTATTGTGTATGTATCTTCCTTCTCCCAGGAGCT ATTTGAAGTGTGTGGACTAATTTGGATTATACTCAAAGAGTTGAGGCAATTATAGTGCTTGAGCCTTGAG ACTGTCTGTTGTTGCCTTCTCAGAGTTTTGCAGCTCAGGGTTGGGGCCTAGTTACAGTTTGGATCCTTAG TCCAAGAATTTTGAGAACGTGAGTAAAACCTTGGCAGGAGCTAAAAAATACTTAAAAGATACCTTGCTAC ATGAGTTCTTTAAAAACCTTCAGTGAATTGTGGAAAAACAAAAAAGCAGTGTGAGATTCCTGCTTATATA AAGTACTTGGGAAACATGAAAGGGAGAAAGGCCATGGCCCACTCACTCTTGCCTTCAGATAGGGAGCTCA AATGTGACTTTAGTTTTCTTGCCTTTTCTGGTTAGAACATAAAGATGTGGGTAGTAGTTTGGGGTAATGG GTTTGCTCATATTACTTCCCTTCTTGTTACTGCTTTTGTTTTCTGTCTCCAACATTTTCATTAGGGCTGT AGCTCCCCACTCTGTGTAGATAAAAGGTGGGTTCAGTCCAGCTATTATTGCCCTGAGGGAACAAACTACT TTTTTGGGAGCAAATGTTCTCCAGCATATAGTTGACAGTGGTTAGGAGCCCTCCCCTTCCCCTGCCCTCC TGTAACAGCAGAATCCTATCCTTCCTCTTCTGTTCATTGTATTGACCAACCAGTAATCCTATTATGTATC TGAGTGTGTGTATAGGGGGAAGGGGTTCTTTACATTTTCTGTGGTTTGTGCTTTTTTCTTCAGTAAATTA GTTCCCACCATCGCATGCCCAGGGGCCACTACCTGGCATTATCGCATGCTGGGATCATTGGGGGAGGGTA GTTTGAAATTCACCACTGTCCTTTGTTTTGGAGATTCTTATTTTTTAATAAGTAATCCGTCCTATACAAA TAGCTAATTAACTCTTGTGTTCCCCCTGCCCATATGGCTGCTGGTGTAAATAAATTGCATTTTCCCATTG CTAAATGATAATAAAATTTAAAAGAAATAAAAAAAAA





lncrnadb version 2.0. lastupdate : 03 Sep 2015