HOTAIR

ENA TPA Accession :
Print
Download


Entry NameAlias
HOTAIR Gm16258, Hox antisense intergenic RNA, ENSG00000228630
Name
Hox antisense intergenic RNA
Characteristics
2.2 kb; spliced, polyadenylated and comprised of 6 exons in humans ((Rinn 2007)).

Transcribed from the HOXC locus from a position intergenic and antisense to the flanking HOXC11 and HOXC12 genes ((Rinn 2007)).
Expression
Expressed in posterior and distal fibroblasts ((Rinn 2007)).

Expression level in cancer is an efficient predictor of metastasis and survival with high expression levels predictive of poor outcomes ((Gupta 2010)). Also in patients with stage IV colorectal cancer (CRC), HOTAIR expression levels were higher in cancerous tissues than in noncancerous tissues, with high HOTAIR expression tightly correlated with the presence of liver metastasis and associated with poor prognosis ((Kogo 2011)) .

Some HOTAIR transcripts localise to the nucleus ((Khalil 2009)).

In situ hybridization analysis of the mouse cognate RNA (mHotair) showed expression similar to Hoxc11, with distinct levels in parts of the proximal hindlimbs, genital bud and tail in embryos at E11.5, as well as in in posterior part of the hindlimb and genital bud at E12.5 ((Schorderet 2011)).

Transcript found to be quite unstable with a half-life >4 hr in human Hela cells ((Tani 2012)).
Function
Originally identified as silencing the HoxD locus but has since been found to epigenetic silence gene expression at many sites across the genome by recruitment of PRC2 and LSD1/CoREST/REST repressive chromatin modifying complexes ((Rinn 2007), (Tsai 2010)).

HOTAIR acts as a scaffold for protein complexes. A 5' domain binds PRC2 while a 3' domain binds LSD1 ((Tsai 2010)).

Oncogene - regulates metastatic progression ((Gupta 2010))((Schorderet 2011)).

HOTAIR dysregulated in breast cancer with frequent overexpression in metastases.
Overexpression of HOTAIR leads to PRC2 re-targeting across the genome to a state similar to that in embryonic fibroblasts, promoting tumour invasion and metatasis. Oncogenic effects of HOTAIR upregulation were dependent on PRC2 ((Gupta 2010)).

Deletion of the HoxC cluster containing the cognate Hotair transcript in mouse showed little phenotypic effect, with little change in the expression on levels of H3K27me3 coverage in corresponding human HOTAIR Hoxd target genes ((Schorderet 2011)).
Conservation
HOTAIR exists in mammals but with poor sequence conservation ((Rinn 2007))((He 2011)). A 239 bp domain in HOTAIR exon 6 is especially conserved in mammals ((He 2011)).

The mouse EST (AK035706) homologous to human HOTAIR is comprised of two exons only, with the second half of the first exon showing similarity to exon 4 of HOTAIR, whereas the second exon is homologous to exon 6 of HOTAIR ((Schorderet 2011)). This may underlie differences in function since the first three exons of HOTAIR (absent from mHotair) contain binding sites for EZH2, while the 3' extremity of human HOTAIR that interact with LSD1 is part of the least conserved DNA sequence within mHotair exon 2 ((Schorderet 2011)).
Human Body Atlas
Sort values
Species
Species UCSC Genome Browser Link
Rattus norvegicus (Rat) rn4 chr7:141,707,460-141,711,096
Canis familiaris (Dog) canFam2 chr27:4,295,507-4,301,867
Pan troglodytes (Chimpanzee) panTro2 chr12:35,582,642-35,589,071
Mus musculus (Mouse) mm9 chr15:102,774,493-102,778,161
Macaca mulatta (Rhesus macaque) rheMac2 chr11:51,060,391-51,066,832
Homo sapiens (Human) hg19 chr12:54,356,092-54,368,740
Literature
Pub Med ID Author Title Year
17604720 Rinn Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. 2007
20393566 Gupta Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. 2010
19571010 Khalil Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. 2009
20616235 Tsai Long noncoding RNA as modular scaffold of histone modification complexes. 2010
21496275 He The sequence, structure and evolutionary features of HOTAIR in mammals. 2011
21862635 Kogo Long noncoding RNA HOTAIR regulates polycomb-dependent chromatin modification and is associated with poor prognosis in colorectal cancers. 2011
21637793 Schorderet Structural and functional differences in the long non-coding RNA hotair in mouse and human. 2011
22369889 Tani Genome-wide determination of RNA stability reveals hundreds of short-lived noncoding transcripts in mammals. 2012

showing of total 9 results

Associated Components
Component Type Component ID Description Pub Med ID
Gene HOXC11 HOTAIR gene is found between and in the antisense orientation from HOXC11 and HOXC12 genes. 17604720
Protein EZH2 HOTAIR binds EZH2 to recruit the PRC2 repressive chromatin modifying complex to chromatin. 17604720
Protein LSD1 HOTAIR binds LSD1 to recruit the LSD1/CoREST/REST repressive chromatin modifying complex to chromatin. 20616235
Sequences
Sequence Name Sequence Accession Species Fasta Sequence
hotair_hg_1 DA567507,DQ926657,AK123741, DQ926657,AK123741,DQ926657,BF109906 Homo sapiens acattctgccctgatttccggaacctggaagcctaggcaggcagtggggaactctgactcgcctgtgctctggagcttgatccgaaagcttccacagtgaggactgctccgtgggggtaagagagcaccaggcactgaggcctgggagttccacagaccaacacccctgctcctggcggctcccacccgggacttagaccctcaggtccctaatatcccggaggtgctctcaatcagaaaggtcctgctccgcttcgcagtggaatggaacggatttagaagcctgcagtaggggagtggggagtggagagagggagcccagagttacagacggcggcgagaggaaggaggggcgtctttatttttttaaggccccaaagagtctgatgtttacaagaccagaaatgccacggccgcgtcctggcagagaaaaggctgaaatggaggaccggcgccttccttataagtatgcacattggcgagagaagtgctgcaacctaaaccagcaattacacccaagctcgttggggcctaagccagtaccgacctggtagaaaaagcaaccacgaagctagagagagagccagaggagggaagagagcgccagacgaaggtgaaagcgaaccacgcagagaaatgcaggcaagggagcaaggcggcagttcccggaacaaacgtggcagagggcaagacgggcactcacagacagaggtttatgtatttttattttttaaaatctgatttggtgttccatgaggaaaagggaaaatctagggaacgggagtacagagagaataatccgggtcctagctcgccacatgaacgcccagagaacgctggaaaaacctgagcgggtgccggggcagcacccggctcgggtcagccactgccccacaccgggcccaccaagccccgcccctcgcggccaccggggcttccttgctcttcttatcatctccatctttatgatgaggcttgttaacaagaccagagagctggccaagcacctctatctcagccgcgcccgctcagccgagcagcggtcggtggggggactgggaggcgctaattaattgattcctttggactgtaaaatatggcggcgtctacacggaacccatggactcataaacaatatatctgttgggcgtgagtgcactgtctctcaaataatttttccataggcaaatgtcagagggttctggatttttagttgctaaggaaagatccaaatgggaccaattttaggaggcccaaacagagtccgttcagtgtcagaaaatgcttccccaaaggggttgggagtgtgttttgttggaaaaaagcttgggttataggaaagcctttccctgctacttgtgtagacccagcccaatttaagaattacaaggaagcgaaggggttgtgtaggccggaagcctctctgtcccggctggatgcaggggacttgagctgctccggaatttgagaggaacatagaagcaaaggtccagcctttgcttcgtgctgattcctagacttaagattcaaaaacaaatttttaaaagtgaaaccagccctagcctttggaagctcttgaaggttcagcacccacccaggaatccacctgcctgttacacgcctctccaagacacagtggcaccgcttttctaactggcagcacagagcaactctataatatgcttatattaggtctagaagaatgcatcttgagacacatgggtaacctaattatataatgcttgttccatacaggagtgattatgcagtgggaccctgctgcaaacgggactttgcactctaaatatagaccccagcttgggacaaaagttgcagtagaaaaatagacataggagaacacttaaataagtgatgcatgtagacacagaaggggtatttaaaagacagaaataatagaagtacagaagaacagaaaaaaaatcagcagatggagattaccattcccaatgcctgaacttcctcctgctattaagattgctagagaattgtgtcttaaacagttcatgaacccagaagaatgcaatttcaatgtatttagtacacacacagtatgtatataaacacaactcacagaatatattttccatacattgggtaggtatgcactttgtgtatatataataatgtattttccatgcagttttaaaatgtagatatattaatatctggatgcattttctgtgcactggttttatatgccttatggagtatatactcacatgtagctaaatagactcaggactgcacattccttgtgtaggttgtgtgtgtgtggtggttttatgcataaataaagttttacatgtggtgaaaaaa





lncrnadb version 2.0. lastupdate : 03 Sep 2015